|
Addgene inc
pspcas9 bb 2a gfp Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspcas9 bb 2a gfp/product/Addgene inc Average 96 stars, based on 1 article reviews
pspcas9 bb 2a gfp - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
pspcas9 bb 2a gfp mapre3 Pspcas9 Bb 2a Gfp Mapre3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspcas9 bb 2a gfp mapre3/product/Addgene inc Average 93 stars, based on 1 article reviews
pspcas9 bb 2a gfp mapre3 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pspcas9 wt bb 2a gfp targeting human trim21 ![]() Pspcas9 Wt Bb 2a Gfp Targeting Human Trim21, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspcas9 wt bb 2a gfp targeting human trim21/product/Addgene inc Average 92 stars, based on 1 article reviews
pspcas9 wt bb 2a gfp targeting human trim21 - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pspcas9 gfp pd l1 ![]() Pspcas9 Gfp Pd L1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspcas9 gfp pd l1/product/Addgene inc Average 90 stars, based on 1 article reviews
pspcas9 gfp pd l1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
human codon optimized pspcas9 ![]() Human Codon Optimized Pspcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human codon optimized pspcas9/product/Addgene inc Average 93 stars, based on 1 article reviews
human codon optimized pspcas9 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pspcas9 bb ![]() Pspcas9 Bb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspcas9 bb/product/Addgene inc Average 92 stars, based on 1 article reviews
pspcas9 bb - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pspcas9 bb 2a gfp mapre1 ![]() Pspcas9 Bb 2a Gfp Mapre1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspcas9 bb 2a gfp mapre1/product/Addgene inc Average 93 stars, based on 1 article reviews
pspcas9 bb 2a gfp mapre1 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
nfatc1 ![]() Nfatc1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nfatc1/product/Addgene inc Average 93 stars, based on 1 article reviews
nfatc1 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
nfatc2 sgrna targeting gactcgcatacccggatgat ![]() Nfatc2 Sgrna Targeting Gactcgcatacccggatgat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nfatc2 sgrna targeting gactcgcatacccggatgat/product/Addgene inc Average 85 stars, based on 1 article reviews
nfatc2 sgrna targeting gactcgcatacccggatgat - by Bioz Stars,
2026-03
85/100 stars
|
Buy from Supplier |
|
Addgene inc
mouse pd l1 ![]() Mouse Pd L1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse pd l1/product/Addgene inc Average 90 stars, based on 1 article reviews
mouse pd l1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
caccgattcaagtggttgttaagga 30 sequence targeting mouse mlh1 gene ![]() Caccgattcaagtggttgttaagga 30 Sequence Targeting Mouse Mlh1 Gene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caccgattcaagtggttgttaagga 30 sequence targeting mouse mlh1 gene/product/Addgene inc Average 85 stars, based on 1 article reviews
caccgattcaagtggttgttaagga 30 sequence targeting mouse mlh1 gene - by Bioz Stars,
2026-03
85/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Life science alliance
Article Title: FAT10 inhibits TRIM21 to down-regulate antiviral type-I interferon secretion.
doi: 10.26508/lsa.202402786
Figure Lengend Snippet: Figure 1. TRIM21 is covalently modified with FAT10. (A) HEK293T cells were transiently transfected with expression constructs for HA-FAT10 and Myc-DDK-TRIM21. After 24 h, cells were harvested and lysed. Cleared lysate was subjected to immunoprecipitation (IP) using FLAG M2 affinity gel, which specifically recognizes the DDK (FLAG) tag. Proteins were visualized by Western blot analysis under reducing conditions (4% 2-ME) using antibodies reactive to HA or FLAG (DDK). GAPDH was used as a loading control. (B) HEK293T cells were transiently co-transfected
Article Snippet: Plasmids used for the transient transfection of HEK293 cells were pCMV6-Myc-DDK-TRIM21 (RC202088; Origene), pcDNA3.1-HA-FAT10 (Hipp et al, 2004), pcDNA3.1-HA-FAT10AV (Aichem et al, 2010), pcDNA3.1-HA-UBA6 (Aichem et al, 2010), pcDNA-3.1-His/-A-USE1, and its active site cysteine mutant pcDNA-3.1-His/-A-USE1-C188A (Aichem et al, 2010), lentiviral envelop plasmid pMD2.G (#12259; Addgene), and lentiviral packaging plasmid psPAX2 (#12260; Addgene). pSMPP-mCherry-hTRIM21 was a gift from Leo James (plasmid #104972 [Clift et al, 2017]; Addgene), and
Techniques: Transfection, Expressing, Construct, Immunoprecipitation, FLAG-tag, Western Blot, Control
Journal: Life science alliance
Article Title: FAT10 inhibits TRIM21 to down-regulate antiviral type-I interferon secretion.
doi: 10.26508/lsa.202402786
Figure Lengend Snippet: Figure 2. FAT10ylation of TRIM21 is catalyzed by the E1 UBA6 and the E2 USE1. (A) HEK293 WT, or where indicated UBA6 KO and USE1 KO cells, were transiently transfected with HA–FAT10 or HA–FAT10AV and Myc–DDK–TRIM21 expression plasmids. After 24 h, cells were collected and lysed. Cleared cell lysate was subjected to SDS–PAGE and subsequent Western blotting under reducing conditions (4% 2-ME) using antibodies reactive to HA or FLAG (DDK). GAPDH was used as loading control. (B) HEK293 WT, or UBA6 KO and USE1 KO cells were transiently transfected with expression
Article Snippet: Plasmids used for the transient transfection of HEK293 cells were pCMV6-Myc-DDK-TRIM21 (RC202088; Origene), pcDNA3.1-HA-FAT10 (Hipp et al, 2004), pcDNA3.1-HA-FAT10AV (Aichem et al, 2010), pcDNA3.1-HA-UBA6 (Aichem et al, 2010), pcDNA-3.1-His/-A-USE1, and its active site cysteine mutant pcDNA-3.1-His/-A-USE1-C188A (Aichem et al, 2010), lentiviral envelop plasmid pMD2.G (#12259; Addgene), and lentiviral packaging plasmid psPAX2 (#12260; Addgene). pSMPP-mCherry-hTRIM21 was a gift from Leo James (plasmid #104972 [Clift et al, 2017]; Addgene), and
Techniques: Transfection, Expressing, SDS Page, Western Blot, Control
Journal: Life science alliance
Article Title: FAT10 inhibits TRIM21 to down-regulate antiviral type-I interferon secretion.
doi: 10.26508/lsa.202402786
Figure Lengend Snippet: Figure 3. FAT10 targets TRIM21 for degradation by the 26S proteasome. (A) HEK293T cells were transiently transfected with expression constructs for HA–FAT10 and Myc–DDK–TRIM21. After 24 h, cells were treated with cycloheximide and/or MG132 for the indicated time points. Cleared cell lysates were subjected to immunoprecipitation using FLAG M2 affinity gel, which is specific for the DDK- tag. SDS–PAGE and Western blot analysis was performed under reducing conditions (4% 2-ME) using antibodies reactive to HA or FLAG (DDK). GAPDH was used as loading control. Shown is one representative experiment out of three independent experiments with similar outcomes. (B) Densitometric quantification of the FAT10-TRIM21 conjugate fluorescent signal, normalized to the respective GAPDH fluorescent signal. The value of untreated sample was set to 100%. Shown is the mean three independent experiments with similar outcomes. Source data are available for this figure.
Article Snippet: Plasmids used for the transient transfection of HEK293 cells were pCMV6-Myc-DDK-TRIM21 (RC202088; Origene), pcDNA3.1-HA-FAT10 (Hipp et al, 2004), pcDNA3.1-HA-FAT10AV (Aichem et al, 2010), pcDNA3.1-HA-UBA6 (Aichem et al, 2010), pcDNA-3.1-His/-A-USE1, and its active site cysteine mutant pcDNA-3.1-His/-A-USE1-C188A (Aichem et al, 2010), lentiviral envelop plasmid pMD2.G (#12259; Addgene), and lentiviral packaging plasmid psPAX2 (#12260; Addgene). pSMPP-mCherry-hTRIM21 was a gift from Leo James (plasmid #104972 [Clift et al, 2017]; Addgene), and
Techniques: Transfection, Expressing, Construct, Immunoprecipitation, SDS Page, Western Blot, Control
Journal: Life science alliance
Article Title: FAT10 inhibits TRIM21 to down-regulate antiviral type-I interferon secretion.
doi: 10.26508/lsa.202402786
Figure Lengend Snippet: Figure 4. FAT10 modulates the stability of TRIM21 upon influenza A virus (IAV) infection. (A) A549 FLAG-FAT10 cells were infected with IAV (MOI: 1) as indicated and uninfected A549 cells were used as control. After 24 h, cells were harvested and lysed. Precleared cell lysates were subjected to Ni–IDA pull-down assay and incubated overnight at 4°C. Beads were washed four times with lysis buffer. SDS–PAGE under reducing conditions (4% 2-ME) followed by Western blotting was performed using the indicated antibodies. GAPDH was used as the loading control. Asterisk marks
Article Snippet: Plasmids used for the transient transfection of HEK293 cells were pCMV6-Myc-DDK-TRIM21 (RC202088; Origene), pcDNA3.1-HA-FAT10 (Hipp et al, 2004), pcDNA3.1-HA-FAT10AV (Aichem et al, 2010), pcDNA3.1-HA-UBA6 (Aichem et al, 2010), pcDNA-3.1-His/-A-USE1, and its active site cysteine mutant pcDNA-3.1-His/-A-USE1-C188A (Aichem et al, 2010), lentiviral envelop plasmid pMD2.G (#12259; Addgene), and lentiviral packaging plasmid psPAX2 (#12260; Addgene). pSMPP-mCherry-hTRIM21 was a gift from Leo James (plasmid #104972 [Clift et al, 2017]; Addgene), and
Techniques: Virus, Infection, Control, Pull Down Assay, Incubation, Lysis, SDS Page, Western Blot
Journal: Life science alliance
Article Title: FAT10 inhibits TRIM21 to down-regulate antiviral type-I interferon secretion.
doi: 10.26508/lsa.202402786
Figure Lengend Snippet: Figure 5. FAT10-mediated inhibition of TRIM21 down-regulates IFNβ secretion upon influenza A virus (IAV) infection. (A) A549 WT, FLAG–FAT10, TRIM21 KO, TRIM21 KO/FLAG–FAT10 cells were infected with IAV (MOI: 1). After 24 h, supernatants and cell pellets were collected. Cell pellets were lysed and cleared cell lysates were subject to SDS–PAGE under reducing conditions (4% 2-ME) followed by Western blot analysis with the indicated antibodies. GAPDH was used as the loading control. (B) IFNβ ELISA was performed with the cell culture supernatants from (A). (C) A549 WT, FLAG–FAT10, mCherry-TRIM21, mCherry-
Article Snippet: Plasmids used for the transient transfection of HEK293 cells were pCMV6-Myc-DDK-TRIM21 (RC202088; Origene), pcDNA3.1-HA-FAT10 (Hipp et al, 2004), pcDNA3.1-HA-FAT10AV (Aichem et al, 2010), pcDNA3.1-HA-UBA6 (Aichem et al, 2010), pcDNA-3.1-His/-A-USE1, and its active site cysteine mutant pcDNA-3.1-His/-A-USE1-C188A (Aichem et al, 2010), lentiviral envelop plasmid pMD2.G (#12259; Addgene), and lentiviral packaging plasmid psPAX2 (#12260; Addgene). pSMPP-mCherry-hTRIM21 was a gift from Leo James (plasmid #104972 [Clift et al, 2017]; Addgene), and
Techniques: Inhibition, Virus, Infection, SDS Page, Western Blot, Control, Enzyme-linked Immunosorbent Assay, Cell Culture
Journal: Life science alliance
Article Title: FAT10 inhibits TRIM21 to down-regulate antiviral type-I interferon secretion.
doi: 10.26508/lsa.202402786
Figure Lengend Snippet: Figure 6. Cartoon summarizing FAT10 mediated inhibition of type-I IFN signaling. TNF/IFNγ induces the expression of FAT10 (blue arrow). FAT10-mediated down-regulation of type-I IFN happens in two ways: (I) influenza A virus infection upregulates TRIM21 expression (blue arrow). TRIM21 positively regulates the antiviral type-I IFN production through a positive feedback loop (blue arrow). FAT10 inhibits TRIM21 by directly binding to its PRYSPRY domain, causing either degradation of TRIM21 by the 26S proteasome, and/or inhibiting TRIM21 auto- ubiquitination, thus down-regulating the production of type-I IFN. (II) FAT10 gets phosphorylated upon influenza A virus infection. Phosphorylated FAT10 stabilizes and activates OTUB1, which inhibits type-I IFN production (Saxena et al, 2024).
Article Snippet: Plasmids used for the transient transfection of HEK293 cells were pCMV6-Myc-DDK-TRIM21 (RC202088; Origene), pcDNA3.1-HA-FAT10 (Hipp et al, 2004), pcDNA3.1-HA-FAT10AV (Aichem et al, 2010), pcDNA3.1-HA-UBA6 (Aichem et al, 2010), pcDNA-3.1-His/-A-USE1, and its active site cysteine mutant pcDNA-3.1-His/-A-USE1-C188A (Aichem et al, 2010), lentiviral envelop plasmid pMD2.G (#12259; Addgene), and lentiviral packaging plasmid psPAX2 (#12260; Addgene). pSMPP-mCherry-hTRIM21 was a gift from Leo James (plasmid #104972 [Clift et al, 2017]; Addgene), and
Techniques: Inhibition, Expressing, Virus, Infection, Binding Assay, Ubiquitin Proteomics
Journal: Cancer Immunology Research
Article Title: T Cells Expressing Receptor Recombination/Revision Machinery Are Detected in the Tumor Microenvironment and Expanded in Genomically Over-unstable Models
doi: 10.1158/2326-6066.cir-20-0645
Figure Lengend Snippet: Figure 2. T cells expressing Rag1/2 and Dntt increase in Mlh1-ko 4T1 tumors. A–H, Representative input (left) and output (right) images and quantitative analyses of pgH2AX (A and B), CD3 (C and D), Rag1/Rag2 (E and F), and Dntt (G and H) to assess the differences between WT and Mlh1/ mice in the 4T1 model (n ¼ 4 mice/group). Original magnification, 630. Scale bar, 25 mm. I–L, Comparative images and quantitative analyses of mRNA in situ hybridization for Rag1/Rag2 and IHC for CD3 (I and J) or CD8 (K and L), assessing the percentage of CD3þ or CD8þ cells expressing Rag1/2 in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. M–P, Comparative images and quantitative analyses of mRNA in situ hybridization for Dntt and IHC for CD3 (M and N) or CD8 (O and P) showing the percentage of CD3þ or CD8þ T cells expressing Dntt in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. Statistical analysis: two-tailed unpaired Student t test (B, D, F, H, J, L, N, and P). Mean standard error shown; , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001.
Article Snippet: The
Techniques: Expressing, In Situ Hybridization, Two Tailed Test